ID: 1115691301_1115691307

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1115691301 1115691307
Species Human (GRCh38) Human (GRCh38)
Location 14:35846744-35846766 14:35846774-35846796
Sequence CCAGTTTCCCCAGGTAAACTTAC CCATTGTGATAAATATTTTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 122} {0: 1, 1: 0, 2: 0, 3: 29, 4: 373}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!