ID: 1115754702_1115754710

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1115754702 1115754710
Species Human (GRCh38) Human (GRCh38)
Location 14:36519509-36519531 14:36519525-36519547
Sequence CCGAGTCCTCCTTAATTGGCTTG TGGCTTGAGTGGAGGCTCGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 131} {0: 1, 1: 0, 2: 0, 3: 18, 4: 146}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!