ID: 1115755068_1115755072

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1115755068 1115755072
Species Human (GRCh38) Human (GRCh38)
Location 14:36521043-36521065 14:36521061-36521083
Sequence CCAGGCTTCAAGTGTGGGCCCCG CCCCGCGCCTTGAGGGTCCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 141} {0: 1, 1: 0, 2: 0, 3: 2, 4: 149}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!