ID: 1115776188_1115776192

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1115776188 1115776192
Species Human (GRCh38) Human (GRCh38)
Location 14:36717851-36717873 14:36717894-36717916
Sequence CCATCAACCTTATAAAGAGAGGA TGAGCGTCAGGAAAAATGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 169} {0: 1, 1: 0, 2: 0, 3: 15, 4: 175}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!