ID: 1115788563_1115788565

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1115788563 1115788565
Species Human (GRCh38) Human (GRCh38)
Location 14:36854348-36854370 14:36854364-36854386
Sequence CCTTGAAGGATGAGAGACTTTTC ACTTTTCCCCAGATGGAGCTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 218} {0: 1, 1: 0, 2: 2, 3: 58, 4: 362}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!