ID: 1115789252_1115789254

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1115789252 1115789254
Species Human (GRCh38) Human (GRCh38)
Location 14:36860341-36860363 14:36860368-36860390
Sequence CCTTGGAAACAGAATATCAGATT GAAGCCTCCAAGACCATGTAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 23, 4: 295} {0: 1, 1: 0, 2: 2, 3: 4, 4: 96}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!