ID: 1115790403_1115790407

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1115790403 1115790407
Species Human (GRCh38) Human (GRCh38)
Location 14:36871258-36871280 14:36871290-36871312
Sequence CCTTGCTCTTTCACCATGTGAGG GAAGGCACCCTTTATGAACCAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 14, 3: 74, 4: 370} {0: 1, 1: 4, 2: 42, 3: 184, 4: 380}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!