ID: 1115790403_1115790409

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1115790403 1115790409
Species Human (GRCh38) Human (GRCh38)
Location 14:36871258-36871280 14:36871297-36871319
Sequence CCTTGCTCTTTCACCATGTGAGG CCCTTTATGAACCAGGAAACAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 14, 3: 74, 4: 370} {0: 1, 1: 0, 2: 38, 3: 237, 4: 702}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!