ID: 1115889554_1115889566

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1115889554 1115889566
Species Human (GRCh38) Human (GRCh38)
Location 14:38011573-38011595 14:38011619-38011641
Sequence CCGGACTTGGGGAACCTGCCGGG CACAGAAGAAGACAGCAAGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 93} {0: 1, 1: 3, 2: 16, 3: 139, 4: 878}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!