ID: 1116034778_1116034781

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1116034778 1116034781
Species Human (GRCh38) Human (GRCh38)
Location 14:39614555-39614577 14:39614582-39614604
Sequence CCAAAATAGAAGTGTTGTCCTGG ATTTTAAAAACACACATTTCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 17, 3: 166, 4: 1196}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!