ID: 1116035544_1116035551

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1116035544 1116035551
Species Human (GRCh38) Human (GRCh38)
Location 14:39622798-39622820 14:39622838-39622860
Sequence CCATCCATGTCCTGCCAAGGACA TATGGCTGCATAATATTCCATGG
Strand - +
Off-target summary {0: 1, 1: 11, 2: 28, 3: 65, 4: 353} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!