ID: 1116044162_1116044169

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1116044162 1116044169
Species Human (GRCh38) Human (GRCh38)
Location 14:39722398-39722420 14:39722427-39722449
Sequence CCTTCCTGATTCTCCTTGCCCAT CTTATTGCTTTCTTTGGCTTGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!