ID: 1116058662_1116058664

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1116058662 1116058664
Species Human (GRCh38) Human (GRCh38)
Location 14:39895047-39895069 14:39895060-39895082
Sequence CCTGTAATTGCTCTTCTCTGTAT TTCTCTGTATGTTGGATCTAAGG
Strand - +
Off-target summary {0: 115, 1: 128, 2: 101, 3: 87, 4: 503} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!