ID: 1116089281_1116089284

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1116089281 1116089284
Species Human (GRCh38) Human (GRCh38)
Location 14:40284477-40284499 14:40284522-40284544
Sequence CCAAACACAAGTGTGATAGGTAG TCCCCAACATTTTTGGCATCAGG
Strand - +
Off-target summary No data {0: 7, 1: 173, 2: 1253, 3: 1748, 4: 1463}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!