ID: 1116126610_1116126617

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1116126610 1116126617
Species Human (GRCh38) Human (GRCh38)
Location 14:40796602-40796624 14:40796649-40796671
Sequence CCTTGGCTGCACAAAGCAGGGGG ATTTTCCCCTTCTAGGCCTCTGG
Strand - +
Off-target summary {0: 1, 1: 5, 2: 187, 3: 747, 4: 1528} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!