ID: 1116126615_1116126623

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1116126615 1116126623
Species Human (GRCh38) Human (GRCh38)
Location 14:40796639-40796661 14:40796664-40796686
Sequence CCAGCAAACAATTTTCCCCTTCT GCCTCTGGGCCTGTGATGGAAGG
Strand - +
Off-target summary No data {0: 51, 1: 588, 2: 1075, 3: 1571, 4: 1778}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!