ID: 1116190588_1116190593

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1116190588 1116190593
Species Human (GRCh38) Human (GRCh38)
Location 14:41660311-41660333 14:41660361-41660383
Sequence CCACCACACCCAGCCATATGACT ATTTCAACCCCAAACCCTGCTGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 73, 3: 585, 4: 3232} {0: 1, 1: 0, 2: 3, 3: 14, 4: 137}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!