|
Left Crispr |
Right Crispr |
| Crispr ID |
1116193649 |
1116193661 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
14:41692557-41692579
|
14:41692600-41692622
|
| Sequence |
CCTCCTAACTTCCCCCACACCAC |
GTTCCCCTTCCTGTGTCCAAGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 0, 2: 7, 3: 152, 4: 2128} |
{0: 27, 1: 68, 2: 83, 3: 92, 4: 251} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|