ID: 1116336961_1116336965

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1116336961 1116336965
Species Human (GRCh38) Human (GRCh38)
Location 14:43668487-43668509 14:43668539-43668561
Sequence CCTATCTTATACTATATGCACCT AGTTCTTAGAGATGTTCAAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 106} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!