ID: 1116377299_1116377301

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1116377299 1116377301
Species Human (GRCh38) Human (GRCh38)
Location 14:44219470-44219492 14:44219513-44219535
Sequence CCTGCTTAAAATCTGAGGAATGC TAATTAGTAGGTCTGATCAAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 5, 4: 112}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!