ID: 1116409713_1116409721

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1116409713 1116409721
Species Human (GRCh38) Human (GRCh38)
Location 14:44607121-44607143 14:44607169-44607191
Sequence CCTGCTACTGGGTCCATAGCTCA TTACATATGTACTCTGTGTCTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 5, 3: 26, 4: 305}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!