ID: 1116409716_1116409721

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1116409716 1116409721
Species Human (GRCh38) Human (GRCh38)
Location 14:44607148-44607170 14:44607169-44607191
Sequence CCCTGTGGCATTTTCCCCATGTT TTACATATGTACTCTGTGTCTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 5, 3: 26, 4: 305}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!