ID: 1116415067_1116415071

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1116415067 1116415071
Species Human (GRCh38) Human (GRCh38)
Location 14:44669262-44669284 14:44669310-44669332
Sequence CCTCTAGGAATTTGGAGCAAGTC TCTCCTTCTGAGAGACAACTCGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 26, 4: 343}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!