ID: 1116452821_1116452831

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1116452821 1116452831
Species Human (GRCh38) Human (GRCh38)
Location 14:45083935-45083957 14:45083971-45083993
Sequence CCTATGGAGGGAAAGGCAGGTAG CGCCCTCGCTCGCGGCGGGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 243} {0: 1, 1: 0, 2: 1, 3: 11, 4: 105}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!