ID: 1116462893_1116462901

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1116462893 1116462901
Species Human (GRCh38) Human (GRCh38)
Location 14:45198052-45198074 14:45198096-45198118
Sequence CCACCAGCCTTCTTTTTAATTTG TAGATTTGGAATAGACAGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 62, 4: 538} {0: 1, 1: 0, 2: 0, 3: 21, 4: 203}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!