ID: 1116484227_1116484233

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1116484227 1116484233
Species Human (GRCh38) Human (GRCh38)
Location 14:45427644-45427666 14:45427660-45427682
Sequence CCATGGGACCAGGGAAAAGAGGG AAGAGGGACCTGGGGCAAGAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 4, 3: 61, 4: 386}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!