ID: 1116562389_1116562393

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1116562389 1116562393
Species Human (GRCh38) Human (GRCh38)
Location 14:46397260-46397282 14:46397278-46397300
Sequence CCTACCTTCCTCTGCTTATCTCA TCTCAGGAATCTCTGACTATAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 12, 4: 220}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!