ID: 1116606738_1116606741

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1116606738 1116606741
Species Human (GRCh38) Human (GRCh38)
Location 14:47008313-47008335 14:47008349-47008371
Sequence CCTAACAGGTAGTGTTGGCAGAA AATGTTATTGTTCTCCTAATTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 134} {0: 1, 1: 0, 2: 1, 3: 18, 4: 230}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!