ID: 1116635492_1116635507

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1116635492 1116635507
Species Human (GRCh38) Human (GRCh38)
Location 14:47389700-47389722 14:47389727-47389749
Sequence CCGCCCTACTTTGCAGTCCTTGG CAGGGTGAAAAAAGGGGGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 157} {0: 1, 1: 0, 2: 3, 3: 46, 4: 584}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!