ID: 1116637573_1116637581

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1116637573 1116637581
Species Human (GRCh38) Human (GRCh38)
Location 14:47416869-47416891 14:47416887-47416909
Sequence CCTCCCCATGCACTTGCACTCTG CTCTGGGTTTGTAATGGAAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 273} {0: 1, 1: 2, 2: 14, 3: 100, 4: 629}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!