|
Left Crispr |
Right Crispr |
| Crispr ID |
1116653745 |
1116653754 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
14:47626588-47626610
|
14:47626614-47626636
|
| Sequence |
CCGGCGCTTGCGGGCCAGCGCGA |
CCGGGTGGGCGTGGCCTTGGCGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 2, 2: 21, 3: 23, 4: 55} |
{0: 6, 1: 462, 2: 497, 3: 387, 4: 544} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|