ID: 1116653745_1116653759

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1116653745 1116653759
Species Human (GRCh38) Human (GRCh38)
Location 14:47626588-47626610 14:47626632-47626654
Sequence CCGGCGCTTGCGGGCCAGCGCGA GGCGGGCCCCGCACTGGGAGCGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 21, 3: 23, 4: 55} {0: 9, 1: 70, 2: 155, 3: 217, 4: 408}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!