ID: 1116706403_1116706408

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1116706403 1116706408
Species Human (GRCh38) Human (GRCh38)
Location 14:48307792-48307814 14:48307808-48307830
Sequence CCTTGGATAGTGGTAACTGCAGA CTGCAGAAACATTTGGGGCTGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 24, 4: 261}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!