ID: 1116725265_1116725273 |
View in Genome Browser |
Spacer: -6 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 1116725265 | 1116725273 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 14:48554767-48554789 | 14:48554784-48554806 |
| Sequence | CCACTCTGCTGCTGCTGCTGCTG | CTGCTGCTGGGGGTGTGGGAGGG |
| Strand | - | + |
| Off-target summary | No data | {0: 1, 1: 3, 2: 21, 3: 136, 4: 992} |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||