ID: 1116725620_1116725624

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1116725620 1116725624
Species Human (GRCh38) Human (GRCh38)
Location 14:48558350-48558372 14:48558391-48558413
Sequence CCTCTTTTACTTTAAACCATGGA ATACCCTTATAGAAGAGTGAAGG
Strand - +
Off-target summary {0: 2, 1: 5, 2: 30, 3: 61, 4: 244} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!