ID: 1116742644_1116742653

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1116742644 1116742653
Species Human (GRCh38) Human (GRCh38)
Location 14:48776435-48776457 14:48776476-48776498
Sequence CCATGCCAACTATGGCCATGGCT GCTCAGGCCATTGCTTCAGAGGG
Strand - +
Off-target summary No data {0: 228, 1: 554, 2: 874, 3: 1224, 4: 1332}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!