ID: 1116780157_1116780161

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1116780157 1116780161
Species Human (GRCh38) Human (GRCh38)
Location 14:49228097-49228119 14:49228124-49228146
Sequence CCTCATCAAACTGCAGGAATGGG CAAAAGCTCTCCCTGATTTCAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!