ID: 1116801562_1116801568

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1116801562 1116801568
Species Human (GRCh38) Human (GRCh38)
Location 14:49449630-49449652 14:49449674-49449696
Sequence CCCTAACAGCATGAATATTTACC GATTTCTACTGAAATGGATCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 144} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!