ID: 1116817903_1116817924

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1116817903 1116817924
Species Human (GRCh38) Human (GRCh38)
Location 14:49599909-49599931 14:49599950-49599972
Sequence CCCTCCAGGCGGGCTGAGGCTGA GGCTCCGGGGGGACCATGCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 182} {0: 4, 1: 0, 2: 0, 3: 17, 4: 156}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!