ID: 1116817905_1116817919

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1116817905 1116817919
Species Human (GRCh38) Human (GRCh38)
Location 14:49599913-49599935 14:49599936-49599958
Sequence CCAGGCGGGCTGAGGCTGAGCCC GGGGCCGGGGCGGGGGCTCCGGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 4, 3: 34, 4: 322} {0: 3, 1: 2, 2: 40, 3: 292, 4: 1914}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!