ID: 1116835801_1116835816

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1116835801 1116835816
Species Human (GRCh38) Human (GRCh38)
Location 14:49768218-49768240 14:49768259-49768281
Sequence CCCGCGCCGCCGCCGCCCGGCTC CTGCAGGCGTGCCCCGGCGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 28, 3: 300, 4: 1372} {0: 1, 1: 0, 2: 0, 3: 6, 4: 118}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!