|
Left Crispr |
Right Crispr |
| Crispr ID |
1116840949 |
1116840953 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
14:49820641-49820663
|
14:49820656-49820678
|
| Sequence |
CCTTCCACGGTCTCCCTCTCATG |
CTCTCATGCCGAGCCAAAGCTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 3, 1: 90, 2: 20, 3: 55, 4: 458} |
{0: 25, 1: 227, 2: 708, 3: 445, 4: 248} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|