|
Left Crispr |
Right Crispr |
| Crispr ID |
1116840949 |
1116840956 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
14:49820641-49820663
|
14:49820677-49820699
|
| Sequence |
CCTTCCACGGTCTCCCTCTCATG |
GGACTGTGCTGCTGCCATCTCGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 3, 1: 90, 2: 20, 3: 55, 4: 458} |
{0: 73, 1: 841, 2: 430, 3: 172, 4: 1041} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|