ID: 1116862173_1116862184

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1116862173 1116862184
Species Human (GRCh38) Human (GRCh38)
Location 14:50003470-50003492 14:50003507-50003529
Sequence CCCCCGGGGGCGCGGGGACGCCC AGCTGCCACGCCCGCGTGGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 200} {0: 1, 1: 0, 2: 1, 3: 16, 4: 345}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!