ID: 1116862997_1116862999

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1116862997 1116862999
Species Human (GRCh38) Human (GRCh38)
Location 14:50009231-50009253 14:50009247-50009269
Sequence CCACAGGAACTTCTAACCTGTTC CCTGTTCCAGTGTGACCCTAAGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 1, 3: 8, 4: 107}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!