ID: 1116866851_1116866861

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1116866851 1116866861
Species Human (GRCh38) Human (GRCh38)
Location 14:50038297-50038319 14:50038350-50038372
Sequence CCGCCCACCTGACTCTTGTTCAC CCAGGCTGTTCAGAGTTGGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 237} {0: 1, 1: 0, 2: 1, 3: 16, 4: 180}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!