ID: 1116869748_1116869755

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1116869748 1116869755
Species Human (GRCh38) Human (GRCh38)
Location 14:50059945-50059967 14:50059963-50059985
Sequence CCACCCATTGGGTCAGACCCATG CCATGCACTCCAGGCACTGAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 20, 4: 189}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!