ID: 1116911249_1116911250

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1116911249 1116911250
Species Human (GRCh38) Human (GRCh38)
Location 14:50467144-50467166 14:50467176-50467198
Sequence CCAATCTACAAGAGAACTTTGTC ACGTGTGACCCATTTTCTTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 110} {0: 1, 1: 0, 2: 1, 3: 7, 4: 129}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!