ID: 1116920746_1116920759

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1116920746 1116920759
Species Human (GRCh38) Human (GRCh38)
Location 14:50571080-50571102 14:50571127-50571149
Sequence CCTGCCCTTTAAGTACCCTGGAA GCTTCCAACAATGAGAGGTGGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 7, 3: 21, 4: 113} {0: 1, 1: 0, 2: 1, 3: 12, 4: 147}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!