|
Left Crispr |
Right Crispr |
| Crispr ID |
1116925825 |
1116925827 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
14:50635868-50635890
|
14:50635893-50635915
|
| Sequence |
CCCAGCTACTTCTGTATTTTTAG |
GAGACAGAGTTTCACCATGTTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 3, 1: 211, 2: 8927, 3: 22915, 4: 15202} |
{0: 2300, 1: 38457, 2: 91951, 3: 133968, 4: 111703} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|